gfp targeting shrna Search Results


lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna  (Shanghai GenePharma)
90
Shanghai GenePharma lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna
GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control <t>shRNA‐treated</t> and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.
Lentiviral Vectors Carrying Gfp And Either Shrna Targeting Gpr171 Mrna Or A Non Targeting Control Shrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/lentiviral+vectors+carrying+gfp+and+either+shrna+targeting+gpr171+mrna+or+a+non+targeting+control+shrna/pmc12050395-122-12-17
Average 90 stars, based on 1 article reviews
lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
lentivirus containing cd209a- or gfp-targeted shrna  (Broad Institute Inc)
90
Broad Institute Inc lentivirus containing cd209a- or gfp-targeted shrna
GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control <t>shRNA‐treated</t> and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.
Lentivirus Containing Cd209a Or Gfp Targeted Shrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/lentivirus+containing+cd209a++or+gfp+targeted+shrna/pmc04030302-135-9-19
Average 90 stars, based on 1 article reviews
lentivirus containing cd209a- or gfp-targeted shrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
lentiviral shrna constructs targeting murine cyld and gfp  (Broad Institute Inc)
90
Broad Institute Inc lentiviral shrna constructs targeting murine cyld and gfp
GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control <t>shRNA‐treated</t> and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.
Lentiviral Shrna Constructs Targeting Murine Cyld And Gfp, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/lentiviral+shrna+constructs+targeting+murine+cyld+and+gfp/pmc02746958-303-7-16
Average 90 stars, based on 1 article reviews
lentiviral shrna constructs targeting murine cyld and gfp - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α)  (Novobio Scientific Inc)
90
Novobio Scientific Inc the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α)
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
The Shrna Hif 1α Targeting The Human Hif 1α Gene (Pad Gfp Shrna Hif 1α), supplied by Novobio Scientific Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/the+shrna+hif+1%CE%B1+targeting+the+human+hif+1%CE%B1+gene++pad+gfp+shrna+hif+1%CE%B1+/pmc08205705-51-6-23
Average 90 stars, based on 1 article reviews
the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
lentiviral3-gfp-shrna specifically targeting maya  (Shanghai GenePharma)
90
Shanghai GenePharma lentiviral3-gfp-shrna specifically targeting maya
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
Lentiviral3 Gfp Shrna Specifically Targeting Maya, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/lentiviral3+gfp+shrna+specifically+targeting+maya/pm34190396-31-1-12
Average 90 stars, based on 1 article reviews
lentiviral3-gfp-shrna specifically targeting maya - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
90
Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/pgphi+gfp+neo+plasmid+containing+vegf+shrna+expression+cassette++target+9+sequence++ggagtaccctgatgagatcga+/pm31846730-75-0-32
Average 90 stars, based on 1 article reviews
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
gfp-labeled recombinant lentiviruses shrna targeting yap  (Shanghai GenePharma)
90
Shanghai GenePharma gfp-labeled recombinant lentiviruses shrna targeting yap
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
Gfp Labeled Recombinant Lentiviruses Shrna Targeting Yap, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/gfp+labeled+recombinant+lentiviruses+shrna+targeting+yap/pm29377205-89-7-23
Average 90 stars, based on 1 article reviews
gfp-labeled recombinant lentiviruses shrna targeting yap - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963)  (Shanghai GenePharma)
90
Shanghai GenePharma gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963)
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
Gfp Labeled Recombinant Lentivirus Shrna Targeting Yap (Shyap 963), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+targeting+shrna/gfp+labeled+recombinant+lentivirus+shrna+targeting+yap++shyap+963+/pm31055605-114-4-21
Average 90 stars, based on 1 article reviews
gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Helicobacter

Article Title: HIF ‐1α‐Induced GPR171 Expression Mediates CCL2 Secretion by Mast Cells to Promote Gastric Inflammation During Helicobacter pylori Infection

doi: 10.1111/hel.70042

Figure Lengend Snippet: GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors carrying GFP and either shRNA targeting GPR171 mRNA or a non‐targeting control shRNA were customized (GenePharma, China).

Techniques: Expressing, Knockdown, Quantitative RT-PCR, Western Blot, Control, shRNA, Infection, Cell Culture, RNA Sequencing, Phospho-proteomics, Enzyme-linked Immunosorbent Assay

DPCs were transfected with pAd-GFP-shRNA-HIF-1α for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).

Journal: American Journal of Translational Research

Article Title: Deferoxamine enhances the migration of dental pulp cells via hypoxia-inducible factor 1α

doi:

Figure Lengend Snippet: DPCs were transfected with pAd-GFP-shRNA-HIF-1α for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).

Article Snippet: A recombinant adenovirus vector carrying the GFP, the shRNA-HIF-1α targeting the human HIF-1α gene (pAd-GFP-shRNA-HIF-1α), or the control adenovirus (pAd-GFP) were constructed by Novobio Biotechnology (Shanghai, China).

Techniques: Transfection, shRNA, Fluorescence, Microscopy